.. _Gene Explorer:

##################
Gene Explorer Tool
##################

.. tags:: educator, reference

The gene explorer (GeneX), from the biology department at `UMB
<https://www.umb.edu/>`_, simulates the transcription, splicing, processing, and
translation of a small hypothetical eukaryotic gene. GeneX allows learners to
make specific mutations in a gene sequence, and it then calculates and displays
the effects of the mutations on the mRNA and protein.

Specifically, the gene explorer does the following:

#. Finds the promoter and terminator.
#. Reads the DNA sequence to produce the pre-mRNA.
#. Finds the splice sites.
#. Splices and tails the mRNA.
#. Finds the start codon.
#. Translates the mRNA.

.. image:: /_images/educator_references/GeneExplorer.png
  :alt: Image of the gene explorer.

For more information about the gene explorer, see
`The Gene Explorer <http://intro.bio.umb.edu/GX/>`_.

********************
Gene Explorer Code
********************

.. code-block:: xml

  <problem>
  <p>Make a single base pair substitution mutation in the gene below that results in a protein that is longer than the protein produced by the original gene. When you are satisfied with your change and its effect, click the <b>SUBMIT</b> button.</p>
  <p>Note that a "single base pair substitution mutation" is when a single base is changed to another base; for example, changing the A at position 80 to a T. Deletions and insertions are not allowed.</p>
  <script type="loncapa/python">
  def genex_grader(expect,ans):
      if ans=="CORRECT": return True
      import json
      ans=json.loads(ans)
      return ans["genex_answer"]=="CORRECT"
  </script>
  <customresponse cfn="genex_grader">
  <editageneinput width="818" height="1000" dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_problem_number="2"/>
  </customresponse>
  </problem>

In this code:

* **width** and **height** specify the dimensions of the application, in
  pixels.
* **genex_dna_sequence** is the default DNA sequence that appears when the
  problem opens.
* **dna_sequence** contains the application's state and the learner's answer.
  This value must be the same as **genex_dna_sequence**.
* **genex_problem_number** specifies the number of the problem. This number is
  based on the five gene editor problems in the MITx 7.00x course--for example,
  if you want this problem to look like the second gene editor problem in the
  7.00x course, you would set the **genex_problem_number** value to 2. The
  number must be 1, 2, 3, 4, or 5.